Journal: Nature Communications

Article Title: A pan-CRISPR analysis of mammalian cell specificity identifies ultra-compact sgRNA subsets for genome-scale experiments

doi: 10.1038/s41467-022-28045-w

Figure Lengend Snippet: a Schematic illustrating difference between classic synthetic lethality and our common genetic architecture . Synthetic lethality consists of many individual Y i functions. These functions are cell-type-specific models with single features. Our proposed common genetic architecture is hypothesized to connect these “private” functions with shared CERES features. A common genetic architecture has many redundant edges, and more interconnected nodes. More nodes suggest that more cell-type-specific phenotypes are predictable, and more edges suggest redundancy. b A network built from the aggregation of all multivariate models. Genes are represented as nodes and feature-target gene relations as edges. Colors represent distinct subnetwork communities that were identified by the Louvain method. c Network communities with (right) and without (left) nodes/edges involving functional CRISPR features for a single Louvain community, and a comparison with our hypothesis from ( a ). Edges are colored based upon the data source; and nodes are colored based on the model score (of top ten feature model) of the corresponding gene as target. d To quantitate the visual similarity between our hypothesis in ( a ) and the data in ( c ) across all Louvain communities, we examined the differences in the clustering coefficient, the average number of neighbors, and the network heterogeneity. e gprofiler2 plots examine the enrichment of functional categories. f Residual plot identifies GO terms that are more (residuals of −log10 P values >10) or less (residuals of -log10 P values < −10) enriched in predictor genes than in target genes. Dots represent shared GO terms among the 100 most significant terms in target and predictor gprofiler2 analysis result. The p- values from gprofiler2 for ( e ) and ( f ) are based on hypergeometric tests with multiple testing corrections using the g:SCS method. Source data are provided as a Source Data file.

Article Snippet: Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178).

Techniques: Functional Assay, CRISPR, Comparison

Journal: Nature Communications

Article Title: A pan-CRISPR analysis of mammalian cell specificity identifies ultra-compact sgRNA subsets for genome-scale experiments

doi: 10.1038/s41467-022-28045-w

Figure Lengend Snippet: a Two separate pooled screens were performed in a cell line (PC9) that was not included in model training and validation. Experiment 1 was the full Brunello library. A 21-day dropout experiment was performed in PC9 cells. Measurements on 18,114 genes were direct and form the gold standard. The L200 can be computationally extracted from the full screen and compared to these gold-standard measurements. A new L200 standalone library of 800 guides targeting 200 genes was cloned. This library can be used to perform a small-scale lossy compression experiment. The data can then be compared to the gold standard. b Correlations of inferred vs measured CERES scores for both screens in ( a ) and a comparison of the predictions between the standalone sets and the computationally extracted L200 set in the Brunello library. c A Venn diagram describes the overlap in “Hits” in the 500 most differentially required genes for growth in PC9 cells. Both of the lossy compression screens from ( a ) and the gold-standard (measured) data are compared. Source data are provided as a Source Data file.

Article Snippet: Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178).

Techniques: Biomarker Discovery, Clone Assay, Comparison

Journal: Cell reports

Article Title: Upregulation of exosome secretion from tumor-associated macrophages plays a key role in the suppression of anti-tumor immunity.

doi: 10.1016/j.celrep.2023.113224

Figure Lengend Snippet: Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Article Snippet: Murine TNF-a: 50-GGTGCCTATGTCTCAGCCTCTT-30 and 50-GCCATAGAA CTGA TGAGAGGGAG-3’; Murine IL-1b: 50- TGGACCTTCCAGGATGAGGACA-3’; Murine IL-6: 50-T ACCACTTCACAAGTCG GAGGC-30 and 50- CTGCAAGTGCATCA TCGTTG TTC-3’; TGF-b: 50-TGATACGCCTGAGTGGCTGTCT-3’; GAPDH: 50-CATCACT GCCACC CAGAAGACTG-30 and 50-ATGCCAGTGAGCTTCCCGTTCAG-3’. shRNA knockdown and CRISPR-Cas9 knockout shRNAs against human RAB27A (NM_004850, GCTGCCAATGGGACAAACATA, CAGGAGAGGTTTCGTAGCTA),96 mouse RAB27A (NM_001301230.1, CGAAACTGGATAA GCCAGCTA, GACAAACATAAGCCACGCGAT), human MADD (NG_029462.1, CCACAAGT ACAAGACGCCAAT, CCTGAAAGTATTTGGGCTAAA), mouse MADD (NM_001177720.1, CCACAAGTACAAGACGCCAAT, CCGCTCATTTATGGCAATGAT) or scrambled shRNA (Addgene, Catalog Number:1864) were co-transfected with viral packaging plasmids to package lentiviral particles using HEK293T cells.

Techniques: Expressing, Clinical Proteomics

Journal: Nature

Article Title: Targeting PIKfyve-driven lipid metabolism in pancreatic cancer.

doi: 10.1038/s41586-025-08917-z

Figure Lengend Snippet: Fig. 3 | PIKfyve inhibition obligates PDAC cells to stimulate a lipogenic transcriptional and metabolic program. a, Schematic of the metabolism- focused CRISPR screen in MIA PaCa-2 cells. Created in BioRender. Cheng, C. (2025) https://BioRender.com/d149928. b,c, Gene enrichment rank plot-based differential sgRNA representation (b) and scatter plot of gene fitness scores (c) of high dose (2,000 nM) and low dose (100 nM) apilimod-treated versus DMSO- treated end-point populations of the CRISPR screen experiment. Graphs show the top 30 synthetically lethal genes involved in fatty acid and sphingolipid synthesis (red), the top 30 synthetically lethal genes involved in cholesterol synthesis (purple) and genes that confer sensitivity to apilimod (blue). d, Metabolic map of sphingolipid and cholesterol synthesis. The figure shows the top 90 synthetically lethal genes involved in fatty acid and sphingolipid

Article Snippet: The human CRISPR metabolic gene knockout library was a gift from David Sabatini (Addgene, 110066)58.

Techniques: Inhibition, CRISPR

Journal: Theranostics

Article Title: Truncated HDAC9 identified by integrated genome-wide screen as the key modulator for paclitaxel resistance in triple-negative breast cancer

doi: 10.7150/thno.44997

Figure Lengend Snippet: Integrated analyses of genome-Wide CRISPR/Cas9 screen and transcriptome sequencing. (A) Workflow of genome wide CRISPR/Cas9 knockout screening with PTX treatment. (B) Single guide RNA (sgRNA) read variations on day 14 after PTX treatment, compared to DMSO treatment. (C) Genes known to sensitize cellular response to PTX treatment. (D) Well-known resistant genes in response to PTX treatment. (E) Diagram illustrates construction of paclitaxel-resistant MDA-MB-231 cells. The cells were treated with 1 µM paclitaxel for 24 h, then changed to normal culture medium for 2 weeks. This procedure was repeated 12 times. (F) Bubble chart exhibiting significant differentially expressed genes with a log 2 -fold change (FC) ≤ -1 or ≥ 1. Bubble size represents the value of log 2 TPM in 231-PTX cells. (G) Triangle chart confirmed previously-reported genes playing a critical role in paclitaxel resistance in cancer. The size of the triangle represents the value of log 2 TPM in 231-PTX cells. (H) Distribution of the top 20 GSEA drug resistant-associated pathways: Taxol agent-related pathways constitute 25% of the total pathways. (I) One of the GSEA enrichment analyses among the top 20 Taxol-related pathways.

Article Snippet: The genome-wide CRISPR knockout (GeCKO v2) library was purchased from Addgene and was expanded to 1000× using an electronic transfection method.

Techniques: Genome Wide, CRISPR, Sequencing, Knock-Out

Journal: Theranostics

Article Title: Truncated HDAC9 identified by integrated genome-wide screen as the key modulator for paclitaxel resistance in triple-negative breast cancer

doi: 10.7150/thno.44997

Figure Lengend Snippet: Paclitaxel-sensitive/resistant candidates and their clinical prognostic values in breast cancer. (A-B) Volcano plot displays gene distribution of paclitaxel-sensitive (A) paclitaxel-resistant (B) candidates. X-axis represents log 2 -fold change of 231-PTX versus 231-WT and Y-axis represents log 10 p value of CRISPR/Cas9-positive (A) / (B) -negative screening. (C-F) Kaplan-Meier analysis of paclitaxel-sensitive candidates. Relapse-free survival Kaplan-Meier plots were based on gene expression, and the auto-select best cut-off was used to sort patients ( p < 0.05). (G-J) Kaplan-Meier plot of paclitaxel-resistant candidates. Relapse-free survival Kaplan-Meier plots were based on gene expression, and the autos-elect best cut-off was used to sort patients ( p < 0.05). (K-L) Cell growth after individual gene knock-out with single guide (sg) RNA was evaluated following treatment with 1 nM paclitaxel or DMSO for 6 d (*: p < 0.05; **: p < 0.01).

Article Snippet: The genome-wide CRISPR knockout (GeCKO v2) library was purchased from Addgene and was expanded to 1000× using an electronic transfection method.

Techniques: CRISPR, Gene Expression, Knock-Out

Journal: BMC cancer

Article Title: Expression of STAT3 and hypoxia markers in long-term surviving malignant glioma patients.

doi: 10.1186/s12885-024-12221-w

Figure Lengend Snippet: Fig. 2 The expression of selected hypoxia-related markers (IDH1, IDH2, HIF1a, HIF1b, HIF2a, EGFR, PTEN, VEGFA, VEGFC and STAT3) in primary glioma cells GBMLe3, GBMLe4 and GBMDo2 (A) and in cryopreserved samples corresponding to the tumor used for particular primary glioma culture derivation (B) at mRNA level. The expression of mRNA was determined by RT-PCR. Data are expressed as fold increase ± SD of averages from two independent experi ments. Beta-2-microglobulin was used as a housekeeping gene. * p < 0.05 GBM26 vs. GBM43; # p < 0.05 GBM26 vs. GBM59

Article Snippet: Crispr/Cas STAT3 knockout cell model Glioma cells U87MG grown to 50–70% confluence were transfected with transfection mixture (gRNA vectors in Opti-MEM I, the donor DNA and Turbofectin 8.0 - the ratios of 3:1 for Turbofectin: DNA) as based on manufacturer’s protocol (STAT3 Human Gene Knockout Kit (CRISPR), CAT#: KN204922, Origene).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction

Journal: BMC cancer

Article Title: Expression of STAT3 and hypoxia markers in long-term surviving malignant glioma patients.

doi: 10.1186/s12885-024-12221-w

Figure Lengend Snippet: Fig. 3 Comparison of tumor growth and drug accumulation in Foxn1-nu mice after implantation of glioma cell lines followed by TMZ treatment. Tumor size of implanted (n = 4) (A) U87MG IDH1wt, U87MG STAT3 KO with and without TMZ (0.9 mg/kg) treatment. Evaluation of accumulation of (B) TMZ and (C) its metabolites AIC inside the brain, tumor and plasma in tumor bearing mice with implanted U87MG IDH1wt, resp. U87MG STAT3 KO. The administration of drug (TMZ– 0.9 mg/kg) begins two weeks after implantation (from day 15. to day 28. daily). Organs were collected 15 min after last TMZ application. Confidence interval values of tumor size are shown as mean ± SD. The data of drug accumulation are expressed as ng per mg of tissue. Measurements were performed in two independent experiments

Article Snippet: Crispr/Cas STAT3 knockout cell model Glioma cells U87MG grown to 50–70% confluence were transfected with transfection mixture (gRNA vectors in Opti-MEM I, the donor DNA and Turbofectin 8.0 - the ratios of 3:1 for Turbofectin: DNA) as based on manufacturer’s protocol (STAT3 Human Gene Knockout Kit (CRISPR), CAT#: KN204922, Origene).

Techniques: Comparison, Clinical Proteomics

Journal: BMC cancer

Article Title: Expression of STAT3 and hypoxia markers in long-term surviving malignant glioma patients.

doi: 10.1186/s12885-024-12221-w

Figure Lengend Snippet: Fig. 4 The expression of selected markers related with hypoxia (IDH1, IDH2, HIF1a, HIF1b, HIF2a, EGFR, PTEN, VEGFA, VEGFC and STAT3) in glioma U87MG and U87MG STAT3 KO glioma cell lines (A) and glioma samples collected from Foxn1-nu mice with implanted U87MG and U87MG STAT3 KO glioma cells on mRNA level (B). Tumors were collected 28 days after glioma cell implantation and processed as described in Materials and methods section

Article Snippet: Crispr/Cas STAT3 knockout cell model Glioma cells U87MG grown to 50–70% confluence were transfected with transfection mixture (gRNA vectors in Opti-MEM I, the donor DNA and Turbofectin 8.0 - the ratios of 3:1 for Turbofectin: DNA) as based on manufacturer’s protocol (STAT3 Human Gene Knockout Kit (CRISPR), CAT#: KN204922, Origene).

Techniques: Expressing

Journal: Journal of Functional Foods

Article Title: Methynissolin confers protection against gastric carcinoma via targeting RIPK2

doi: 10.1016/j.jff.2024.106327

Figure Lengend Snippet: Fig. 1. Increased expression of RIPK2 promotes cachexia in the TgRC mice. (A) The method of generation of RIPK2-tgflox/+ (TgR) mice based on Rosa26 locus (CAG-STOP-RIPK2-EGFP-Rosa26) using the CRISPR/Cas9 system. (B) The generation of TgR/Rosa26-CreERT2 (TgRC) mice using tamoxifen (TAM) injection. (C) The genotype analysis of RIPK2 protein expression in tail tissue of the TgR and TgRC mice. (D) Mouse body weight post tamoxifen (TAM) administration in TgR and TgRC mice (n = 10). (E) Fat mass, lean mass, and weight loss post tamoxifen (TAM) administration in TgR and TgRC mice (n = 10). Mice body composition was analyzed by EchoMRI. (F) Representative images of H&E staining showing the histopathological changes of muscle and WAT tissue in TgR and TgRC mice (n = 5). (G-M) Indicated mice were maintained in metabolic cages. Experimental mice administrated with TAM at the first light cycle. Values are hourly means. The energy balance (G), food intake (H), total energy expenditure (TEE) (I), oxygen consumption (VO2) (J), carbon dioxide production (VCO2) (K), respiratory exchange ratio (RER) (L) and locomotor activity (M) of TgR and TgRC mice post TAM injection were determined (n = 10). (N) The serum albumin, BUN, ALP and GGT contents in the TgR and TgRC mice (n = 10). (O) Kaplan-meier (KM) survival curves of mice. Data were shown as the means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. ns., no significance.

Article Snippet: The RIPK2 gene knockout kit (CRISPR) was obtained from OriGene Technologies, Wuxi, China.

Techniques: Expressing, CRISPR, Injection, Staining, Activity Assay

Journal: Journal of Functional Foods

Article Title: Methynissolin confers protection against gastric carcinoma via targeting RIPK2

doi: 10.1016/j.jff.2024.106327

Figure Lengend Snippet: Fig. 2. Methylnissolin protects against overexpressed RIPK2-associated cachexia in the TgRC mice. (A) A protocol of methylnissolin treatment on TgRC mice with TAM injection. (B) Mouse body weight analysis in TgRC and TgRC mice with increasing dosage of methylnissolin (10 mg/kg, 20 mg/kg and 40 mg/kg) in response to TAM injection (n = 10). (C, D) Fat mass (C) and lean mass (D) in TgRC and TgRC mice (n = 10). (E) Representative images of H&E staining showing the histopathological changes of muscle and WAT tissue in the indicated mice group (n = 5). (F-L) Indicated mice were maintained in metabolic cages. Values are hourly means. The energy balance (F), food intake (G), total energy expenditure (TEE) (H), oxygen consumption (VO2) (I), carbon dioxide production (VCO2) (J), respiratory exchange ratio (RER) (K) and locomotor activity (L) of TgRC + DMSO and TgRC + methylnissolin (40 mg/kg) mice were determined (n = 10). (M) The serum albumin, BUN, ALP and GGT contents in the indicated mice (n = 10). (N) Kaplan-meier (KM) survival curves of mice. Data were shown as the means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. ns., no significance.

Article Snippet: The RIPK2 gene knockout kit (CRISPR) was obtained from OriGene Technologies, Wuxi, China.

Techniques: Injection, Staining, Activity Assay

Journal: Journal of Functional Foods

Article Title: Methynissolin confers protection against gastric carcinoma via targeting RIPK2

doi: 10.1016/j.jff.2024.106327

Figure Lengend Snippet: Fig. 3. Overexpression of RIPK2 impairs lipid homeostasis and blocks lipid biosynthesis. (A) Heatmap showing the serum TG contents alterations in the TgR and TgRC mice in response to fed or fasting conditions (n = 5). (B) Analysis of small (LC-TGs) and large (LC-TGs) levels in fed or fasted TgR and TgRC mice (n = 5). (C) Analysis of small (LC-TGs) and large (LC-TGs) levels in fed or fasted TgR and TgRC mice (n = 5). (D) Heatmap showing the serum TG contents alterations in the fed or fasted TgR and TgRC mice (n = 5). (E) Heatmap showing the serum TG contents in the stomach tissue of Balb/c mice with/without MKN-45-RIPK2 WT or MKN-45-RIPK2 KO tumors (n = 10). (F, G) Lipid biosynthesis analysis in TgR and TgRC mice with TAM administration (F) and in Balb/c mice with/without MKN-45- RIPK2 WT or MKN-45-RIPK2 KO tumors (G) (n = 10). Data were shown as the means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. ns., no significance.

Article Snippet: The RIPK2 gene knockout kit (CRISPR) was obtained from OriGene Technologies, Wuxi, China.

Techniques: Over Expression

Journal: Journal of Functional Foods

Article Title: Methynissolin confers protection against gastric carcinoma via targeting RIPK2

doi: 10.1016/j.jff.2024.106327

Figure Lengend Snippet: Fig. 5. Increased expression of RIPK2 inhibits the ASK signaling pathway. (A) The RNA-seq analysis showing the gene expression profiles in the stomach tissue after TAM administration TgR and TgRC mice (n = 5). (B) KEGG analysis of DEGs by the DAVID database. (C) GSEA enrichment bars for lipid metabolism and ASK signaling pathway. (D) RNA-seq analysis indicating the genes expression alterations of ASK, PPARα, PPARβ, PPARδ, PPARγ, PPARGC1a and PPARGC1b in TgR and TgRC mice (n = 5). (E, F) Analysis of mRNA and protein expression of PPARα, ACLY, CD36, FASN and ACSL1 determined by qPCR (E) and western blotting assay (F) in TgR and TgRC mice (n = 5). (G, H) Analysis of mRNA and protein expression of p-ASK1, PPARα, ACLY, CD36, FASN and ACSL1 determined by qPCR (G) and western blotting assay (H) in TgR and TgRC mice (n = 5). Data were shown as the means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. ns., no significance.

Article Snippet: The RIPK2 gene knockout kit (CRISPR) was obtained from OriGene Technologies, Wuxi, China.

Techniques: Expressing, RNA Sequencing, Gene Expression, Western Blot

Journal: Journal of Functional Foods

Article Title: Methynissolin confers protection against gastric carcinoma via targeting RIPK2

doi: 10.1016/j.jff.2024.106327

Figure Lengend Snippet: Fig. 7. The molecular mechanism diagram by which RIPK2 induces cachexia, and protective effect of methylnissolin on gastric cancer and its associated cachexia progression.

Article Snippet: The RIPK2 gene knockout kit (CRISPR) was obtained from OriGene Technologies, Wuxi, China.

Techniques: